CompCytogen 14(2): 197-210 (2020) COMPARATIVE — Apeerrsrewedopenaccessourmal doi: 10.3897/CompCytogen.v | 4i2.49846 Kas Cyto genetics http://compcytogen.pensoft.net International journal of Plant & Animal Cytogenetics, Karyosystematics, and Molecular Systematics Karyotype and putative chromosomal inversion suggested by integration of cytogenetic and molecular data of the fungus-farming ant Mycetomoellerius iheringi Emery, 1888 Ricardo Micolino!”, Maykon Passos Cristiano”, Danon Clemes Cardoso!” | Programa de Pés-Graduacgao em Genética, Departamento de Genética, Universidade Federal do Parand (UFPR), Centro Politécnico, Jardim das Américas, 81531-990, Curitiba, PR, Brazil 2. Departamento de Bio- diversidade, Evolucao e Meio Ambiente, Universidade Federal de Ouro Preto (UFOP), Ouro Preto, MG, Brazil Corresponding author: Danon Clemes Cardoso (danon@ufop.edu.br) Academic editor: V. Gokhman | Received 3 January 2020 | Accepted 28 February 2020 | Published 7 May 2020 http://zoobank.org/D4889BC8-F259-41 F4-9EB6-CD8F4948BCB8 Citation: Micolino R, Cristiano MP, Cardoso DC (2020) Karyotype and putative chromosomal inversion suggested by integration of cytogenetic and molecular data of the fungus-farming ant Mycetomoellerius iheringi Emery, 1888. Comparative Cytogenetics 14(2): 197-210. https://doi.org/10.3897/CompCytogen.v14i2.49846 Abstract Comparative cytogenetic analyses are being increasingly used to collect information on species evolution, for example, diversification of closely related lineages and identification of morphologically indistinguish- able species or lineages. Here, we have described the karyotype of the fungus-farming ant Mycetomoelle- rius iheringi Emery, 1888 and investigated its evolutionary relationships on the basis of molecular and cytogenetic data. The M. iheringi karyotype consists of 2n = 20 chromosomes (2K = 18M + 2SM). We also demonstrated that this species has the classical insect TTAGG telomere organization. Phylogenetic reconstruction showed that M. iheringi is phylogenetically closer to M. cirratus Mayhé-Nunes & Brandao, 2005 and M. kempfi Fowler, 1982. We compared M. iheringi with other congeneric species such as M. holmgreni Wheeler, 1925 and inferred that MZ. iheringi probably underwent a major pericentric inversion in one of its largest chromosomes, making it submetacentric. We discussed our results in the light of the phylogenetic relationships and chromosomal evolution. Keywords chromosomal evolution, FISH, fungus growing, karyomorphometry, TTAGG, Trachymyrmex Copyright Ricardo Micolino et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. 198 Ricardo Micolino et al. / Comparative Cytogenetics 14: 197-210 (2020) Introduction Fungus-farming ants (Formicidae: Myrmicinae: Attini) are exclusive to the New World and occur mainly in the Neotropical region, with some species found in the Nearctic region (Weber 1966; Rabeling et al. 2007). The most recently diverged species include the well-known leafcutter ants (genera Atta Fabricius, 1804 and Acromyrmex Mayr, 1865) as well as the genera Xerolitor Sosa-Calvo et al., 2018, Sericomyrmex Mayr, 1865 and Trachymyrmex Forel, 1893. Previous phylogenetic analyses have shown that the ge- nus Trachymyrmex is paraphyletic (e.g., Schultz and Brady 2008; Sosa-Calvo et al. 2018; Micolino et al. 2019a). However, this taxonomic complication was recently resolved by multilocus phylogenetic analyses with a comprehensive number of species (Solomon et al. 2019). Thus, a new systematic arrangement of three clades was proposed as fol- lows: Mycetomoellerius Solomon et al. 2019 (former Lheringi group), Paratrachymyrmex Solomon et al., 2019 (former /ntermedius group), and Trachymyrmex (based on the type species Trachymyrmex septentrionalis McCook, 1881). Nevertheless, Trachymyrmex sensu stricto, largely containing North American species, is still most prominently stud- ied (e.g., Rabeling et al. 2007; Seal et al. 2015; Sanchez-Pefia et al. 2017). Cytogenetics encompasses the study of chromosomes that may have direct implica- tions on species evolution, such as the identification of cryptic species and diversification of closely related lineages (White 1978; King 1993). In general, ants exhibit one of the largest chromosomal variability among organisms (reviewed by Lorite and Palomeque 2010), leading to the hypothesis that chromosomal rearrangements, i.e., Robertsonian fissions and fusions (known major rearrangements that can change the chromosomal number within lineages), actively contributed to the diversification of ants (Imai et al. 1988, 2001; Cardoso et al. 2018a). Despite the large number of species in the three genera formerly included into “Trachymyrmex” (about 60 species, see above), there is limited cytogenetic information on this ant group. To date, only seven species have been karyotyped, three of which have not been identified to the species level (see Table 1). On the basis of the available data, the described chromosomal numbers appear to be stable within the three genera, ranging from 2n = 12 to 2n = 22 and predominantly comprising metacentric chromosomes (reviewed by Cardoso et al. 2018a). Table |. Former “Trachymyrmex” species with their described karyotypes. 2n: diploid chromosome num- ber; (n): haploid chromosome number; 2K: karyotype formula; Locality: sampling site; M: metacentric chromosomes; SM: submetacentric chromosomes. Species 2n (n) 2K Locality References Mycetomoellerius fuscus* 18 (9) 16M +2SM Minas Gerais State, Brazil Barros et al. (2013a) Mycetomoellerius holmgreni 20 (10) 20M Minas Gerais State, Brazil Barros et al. (2018) Mycetomoellerius iheringi 20 (10) 18M+2SM — Santa Catarina State, Brazil Present study Mycetomoellerius relictus 20 (10) 20M Minas Gerais State, Brazil Barros et al. (2013b) Trachymyrmex septentrionalis 20 (10) 20M Barro Colorado Island, Panama Murakami et al. (1998) “Trachymyrmex” sp. 1 12 (6) 12M Barro Colorado Island, Panama Murakami et al. (1998) “Trachymyrmex” sp. 2 18 (9) 18M Barro Colorado Island, Panama Murakami et al. (1998) “Trachymyrmex” sp. 3 22(11) 18M+4SM Minas Gerais State, Brazil Barros et al. (2013b) * current junior synonym of M. urichii. Karyotype of fungus-farming ant Mycetomoellerius iheringi 199 Mycetomoellerius iheringi Emery, 1888, the type species of the genus, is a species endemic to South America, and it occurs mainly in the southern regions. The exclusive characteristic of . iheringi is the finely striated discal area of the mandibles, which sets it apart from the congeneric species Mycetomoellerius kempfi Fowler, 1982 (May- hé-Nunes and Brandao 2005). A feature of M. iheringi biology that facilitates field identification is the subterranean nest in the sand with a slim opening (Mayhé-Nunes and Brandao 2005). Some groups have been identified by morphological similarities within the former “Trachymyrmex’, including the /heringi group that also includes Mycetomoellerius holmgreni Wheeler, 1925 whose karyotype has been already described (Mayhé-Nunes and Brandao 2005; Barros et al. 2018). This fact allows cytogenetic comparisons with M. iheringi. However, the phylogenetic position of M. sheringi has not yet been described; only the relationship between its fungal cultivars has been re- ported (see Solomon et al. 2019). Here, we have described the M. theringi karyotype on the basis of karyomorpho- metric analysis and fluorescence in situ hybridization (FISH) with a telomeric probe. In addition, we identified the phylogenetic position of M. iheringi and examined its relationship with other species of the genus. We have discussed our results in the light of chromosomal evolution among fungus-farming ants. Material and methods Colony sampling Colonies of M. iheringi were collected from the Restinga environment of the Bra- zilian Atlantic coast at Joaquina Beach, Florianépolis, Santa Catarina State, Brazil (27°37'44"S; 48°26'52"W). A total of five distantly spaced colonies were sampled. Such colonies were maintained in vivo at the Laboratério de Genética Evolutiva e de Populacgées, Universidade Federal de Ouro Preto, Brazil, according to the protocol established by Cardoso et al. (2011). Chromosome preparation and FISH mapping Metaphase chromosomes from the brain ganglia of pre-pupal larvae were obtained using the method of Imai et al. (1988). The ganglia were dissected under a ster- eomicroscope and incubated in hypotonic solution containing 1% sodium citrate and 0.005% colchicine for 60 min, and consecutively dissociated and fixed on ste- reoscopic microscope slides in acetic acid: ethanol: distilled water (3:3:4) and acetic acid: ethanol (1:1). Subsequently, the metaphase chromosomes were examined under a phase-contrast microscope and stained with 4% Giemsa stain dissolved in Sorensen’s buffer, pH 6.8, to determine the chromosome number and morphology. We classified the chromosomes according to the nomenclature proposed by Levan et al. (1964), which is based on the ratio of the chromosomal arms (7), given by centromere posi- 200 Ricardo Micolino et al. / Comparative Cytogenetics 14: 197-210 (2020) tion. The chromosomes were classified into metacentric (7 = 1.0—1.7), submetacen- tric (7 = 1.7—3.0), subtelocentric (rv = 3.0—7.0), and acrocentric (7 > 7.0) categories, as modified by Crozier (1970). The metaphase chromosomes were measured using IMAGE-PRO PLUS software (Media Cybernetics, LP, USA), and the values were calibrated by the scale bar and transferred to EXCEL (Microsoft, Redmond, WA, USA). In addition, the degree of variation and karyotype measurement were validated using statistical tests, according to Cristiano et al. (2017). FISH experiments were performed as previously described by Kubat et al. (2008), with detailed modifications for ants by Micolino et al. (2019a). For the hybridiza- tions, we used the WEAGGs, telomeric motif, which has fine conservation in most insects and the advantage of being able to detect chromosomal rearrangements such as telomere-related inversions and fusions. The TTAGG, probe was directly labeled with Cy3 at the 5' terminal during synthesis (Sigma, St. Louis, MO, USA). The sum- marized technique involves several saline washes, alcohol dehydration, and formamide denaturation, until hybridization with the probe. For visualization, the metaphase chromosomes were stained with 4',6-diamidino-2-phenylindole (DAPI Fluoroshield, Sigma-Aldrich) in an antifade solution. The metaphase chromosomes were analyzed under an OLYMPUS BX53 epifluorescence microscope with OLYMPUS CELLSENS IMAGING software (Olympus American, Inc., Center Valley, PA, USA), using WU (330-385 nm) and WG (510-550 nm) filters for DAPI and rhodamine, respectively. About 10—20 metaphases were analyzed in both cytogenetic analyses, and the images were edited with ADOBE PHOTOSHOP CC software. DNA extraction, sequencing, and phylogenetic analysis We extracted the DNA from ™. iheringi ant workers, according to the standard CTAB/chloroform technique (Sambrook and Russell 2001). We sequenced the frag- ments of four nuclear genes, elongation factor I-alpha-F1 (EF1a-F1), elongation fac- tor 1-alpha-F2 (EF la-F2), wingless (Wg), and long-wavelength rhodopsin (LWRh), and one mitochondrial gene, cytochrome c oxidase I (COI) (GenBank accession numbers: MT174160-—MT174169). The primers used to generate the sequence data are listed in Table 2. Polymerase chain reaction was performed using a final volume of 25 pL, according to the manufacturer’s instructions (Promega, Madison, WI, USA). The amplification conditions and sequencing were based on the methodology outlined in previous studies (see Schultz and Brady 2008, Cardoso et al. 2015a, b, Ward et al. 2015). The gene fragments were aligned and concatenated using MEGA7 software (Ku- mar et al. 2016) and incorporated into the dataset of Solomon et al. (2019). The phylogeny was inferred using the maximum likelihood criterion in RAxML (Stama- takis 2014) by using the simultaneous best-tree search and rapid bootstrapping analy- sis (1000 replicates) with the GIR + G model of evolution. The generated tree and branch labels were visualized using FIGTREE software (Rambaut 2009). Karyotype of fungus-farming ant Mycetomoellerius iheringi 201 Table 2. Primers used for sequencing four nuclear (EFla-F1, EFla-F2, Wg and LW Rh) and one mito- chondrial (COZ) gene fragments in the fungus-farming ant Mycetomoellerius iheringi. Primer Sequence 5' to 3' Source EFla-F1 1424F GCGCCKGCGGCTCTCACCACCGAGG Brady et al. (2006) 1829R GGAAGGCCTCGACGCACATMGG Brady et al. (2006) EFla-F2 557F GAACGTGAACGTGGTATYACSAT Brady et al. (2006) 1118R TTACCTGAAGGGGAAGACGRAG Brady et al. (2006) LW Rh LR143F GACAAAGTKCCACCRGARATGCT Ward and Downie (2005) LR639ER YTTACCGRTTCCATCCRAACA Ward and Downie (2005) We wg578F TGCACNGTGAARACYTGCTGGATGCG — Ward and Downie (2005) wg1032R ACYTCGCAGCACCARTGGAA Abouheif and Wray (2002) COI LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Results Cytogenetic data The karyotype of M. theringi has 2n = 20 chromosomes (Fig. 1). Our karyomorphometric analysis revealed that this karyotype consists of nine metacentric pairs and one submeta- centric pair; the karyotype formula is 2K = 18M + 2SM, and the fundamental number is FN = 40. The total average length of all chromosomes (i.e., of the diploid karyotype) was estimated to be 82.51 = 0.52 um. The average chromosome length ranged from 5.77 £0.91 um to 3.37 + 0.4 um (Table 3). The telomere distribution of the LAGS Ge motif was displayed at both ends of all MZ. iheringi chromosomes (Fig. 2a). No signals for interstitial telomeric sites (ITS) were detected using this probe. Moreover, DAPI staining revealed that both arms of all chromosomes were completely labeled, i.e., mostly A-T rich, whereas the centromeric region showed no labeling for this fluorochrome (Fig. 2b). Molecular data The maximum likelihood phylogeny showed M. iheringi as the sister species of a line- age defined as Mycetomoellerius n.sp. nr cirratus (see Solomon et al. 2019) (bootstrap value, PB = 90). The clade composed of M. cirratus Mayhé-Nunes & Brandao, 2005 + M. kempfi (PB = 98) forms the sister group of M. iheringi + M. n.sp. nr cirratus (PB = 88). The species M. holmgreni previously diverged from the aforementioned clades (PB = 89), and M. papulatus Santschi, 1922 was estimated to be the most basal of the “Theringi group” (PB = 93) (Fig. 3). Discussion Here, we have provided the karyotypic description of the fungus-farming ant Myce- tomoellerius iheringi, which has 2n = 20 chromosomes; we presented its phylogenetic 202 Ricardo Micolino et al. / Comparative Cytogenetics 14: 197-210 (2020) ‘ { a é ' M 8 te Ks. CCR UL ay ta as as atts e=\ 5G, 8 Re uo sat yi oy _-3, 84 Figure |. Mitotic metaphase of Mycetomoellerius iheringi with 2n = 20 chromosomes and its karyotypic morphology. M: metacentric chromosomes; SM: submetacentric chromosomes. Scale bar: 5 um. Table 3. Karyomorphometric analysis of the chromosomes of Mycetomoellerius iheringi. TL: total length; L: long arm length; S: short arm length; RL: relative length; 7: arm ratio (= L/S); ):: total average length of all chromosomes or Karyotype lenght (KL). Chromosome TL L S RL r Classification 1 5:7720.91 3.03+0.48 2.74+0.43 6.97+0.34 1.140.05 Metacentric 2 5.46+0.75 2.86+0.46 2.60.32 6.6140.24 1.14£0.08 Metacentric 3 5.09+0.66 3.02+0.41 2.08£0.27 6.17£0.29 1.46+0.09 Metacentric 4 4.7140.53 2.67£0.29 2.04+0.28 5.72+0.34 1.32+0.12 Metacentric 5 4.38+0.49 2.38+0.29 1.99+0.29 5.31+40.2 1.21+0.18 Metacentric 6 4.2+0.46 2.340.23 1.9140.27 5.140.15 1.22+0.14 Metacentric zi 4.07+0.46 2.24+0.2 1.83+0.33 4.94+0.16 1.26+0.21 Metacentric 8 4.0140.44 2.340.26 1.72+0.26 4.87+0.16 1.32+0.19 Metacentric 9 3.89£0.43 2.19+0.3 1.7+0.18 4.72+0.11 1.31+0.14 Metacentric 10 3.8340.45 2.16+0.3 1.67£0.17 4.65+0.06 1.3+0.11 Metacentric 11 3.78£0.43 2.15£0.28 1.63+0.2 4.59+0.1 1.32+0.15 Metacentric 12, 3.73+0.41 2.07+0.3 1.66+0.15 4.53+0.15 1.25+0.15 Metacentric 13 B:7£0;39 2.03+0.26 1.67+0.19 4.5+0.14 1.22+0.14 Metacentric 14 3.66+0.4 2.08+0.24 1.58+0.2 4.44+0.13 1.33+0.14 Metacentric 15 3.58+0.35 2.01£0.28 1.57+0.13 4.35+0.13 1.29+0.17 Metacentric 16 3.5440.38 2.01£0.26 1.5440.17 4.3+0.12 1.32+0.16 Metacentric 17 3.51+0.4 2.04+0.19 1.4740.25 4.26+0.13 1.41+0.16 Metacentric 18 3.37+0.4 1.94£0.29 1.43+0.12 4.09+0.11 1.36£0.13 Metacentric 19 4.29+1.1 2.74+0.68 1.56+0.42 Be E72. 1.77£0.06 Submetacentric 20 3.9440.59 251037 1.43+0.22 4.76+0.25 1.76£0.03 Submetacentric ys 82.51+0.52 position in the clade of the “Jheringi group”. Considering the cytogenetic data avail- able from fungus-farming ants, we observed a numerical constancy among the karyo- types of the lineages that diverged most recently (i.e., leafcutter ants of the genera Atta and Acromyrmex), suggesting this karyotypic characteristic is shared by the relatively recent lineages. Trachymyrmex septentrionalis, a sister clade of leafcutter ants, has 2n = 20 metacentric chromosomes, equal to those of two Mycetomoellerius species, M. holmgreni and M. relictus Borgmeier, 1934 (see Table 1). All Atta species karyotyped to Karyotype of fungus-farming ant Mycetomoellerius iheringi 203 Figure 2. DAPI-stained Mycetomoellerius iheringi chromosomal metaphases a FISH mapping of the TTAGG,, telomeric motif on haploid metaphase b chromosomes uniformly stained with DAPI fluoro- chrome, except for the centromeric region. Scale bar: 5 um. 4100 » Mycetarotes acutus Mycetarotes acutus 00 Mycetagroicus inflatus 100 Mycetagroicus cerradensis Mycetagroicus triangularis 80 Xerolitor explicatus rar or a0 ~